pastelstar pastelstar
  • 02-03-2020
  • Geography
contestada

Canada is a ____ nation; it has two official languages.
A. Bicultural.
B. Bipartisan.
C. Binominal.
D. Bionic.

Respuesta :

meredith48034
meredith48034 meredith48034
  • 02-03-2020

Answer:

bicultural

Explanation:

Answer Link
fudgekendalyn12 fudgekendalyn12
  • 13-07-2021

Answer:

BICULTURAL

Explanation:

Answer Link

Otras preguntas

Compared to citizens of other nations, americans are _______ involved in politics and community affairs and vote at ________ levels.
How did censorship and propaganda help fortify post ww1 dictatorships?
PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a
How many significant figures are there is the numerical value: 0.00019?
What is let’s read a book in French
When Anne begins to think about a boy friend, someone in turn drives her to think about Peter van Daan. Who? Peter Wessel Miep de Jong Harry Goldberg
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
hich of the following sentences is correct? A. Seven thousands of people showed up for the concert. B. Does anyone know why Steve ordered five dozens of eggs? C
The roman cubitus is an ancient unit of measure equivalent to 0.554m . Convert 2.22/m height of basketball forward to cubiti
PLSSSSSS HELP 30PTSSSSSS!!!!!!!!!!!!!