SavannahBanana21 SavannahBanana21

03-10-2020
Mathematics

contestada

What is the image of (-4,-5) after a dilation by a scale factor of 3 centered at the origin?

Respuesta :

mayahcolbert53 mayahcolbert53

11-12-2020

Answer:(-12,-15)

Step-by-step explanation:

Answer Link

Otras preguntas

30.0 ml of an hf solution were titrated with 22.15 ml of a 0.122 m koh solution to reach the equivalence point. what is the molarity of the hf solution?

I know you would not mind if we could fight and wrest the scepter from your hands. you know that we are powerless to do that, for you have ensured our incapacit

The table shows the battery life of four different mobile phones: Mobile Phone Battery Life Phone Battery Life (hours) A 20 B 25 C 10 D 18 If 8.45% of the batte

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The element with the most stable nucleus and smallest mass per particle is

Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.

2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.

Studies of populations that reveal correlations between dietary habits and disease incidence are

Quadrilateral abcd is inscribed in this circle. what is the measure of angle a?

With this sole proprietorship, who pays the taxes?