reblc73
reblc73 reblc73
  • 01-11-2016
  • English
contestada

Which statement about direct objects is true?

Respuesta :

Loliypop3
Loliypop3 Loliypop3
  • 01-11-2016
Direct objects are only found in sentences with action verbs! :)
Answer Link
Аноним Аноним
  • 01-11-2016
A direct object is usually a noun or a pronoun
Answer Link

Otras preguntas

What is the value of x?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
punctuated equilibrium definition biology
the members of an animal community are usually similar in
The oxygen moves into the blood system from the lungs by the process. A.Exhalation B.Osmosis C.Diffusion D.Respiration
Exercise has numerous health benefits. It conditions your heart and lungs and helps your body fight disease. Many people believe that exercise can help you look
A cat falls out of a tree and takes 1.4 seconds to land safely on its paws on the ground how many meters did the cat fall ?
A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.
Which tortoises, mainland or island, need to eat more food per gram of their body mass?
The available farmland in Mali is in the northeast. True or false