hskfkrjgjrjjfrj hskfkrjgjrjjfrj

01-03-2021
Mathematics

contestada

In the month of February I spent 37.45 on coffee and a mug.... How many refills did I get?

8.95 +1.50r= Total

Someone help ASAP!

Respuesta :

rsalynn rsalynn

01-03-2021

8.95 + 1.50r= 37.45

find the value of r ...

which is 19

19 refills

Answer Link

Otras preguntas

the value x+x(x×) when x = 2

Which are True or False ?

which department or agency conducts foreign policy and protects u s citizens in other countries?

Which of the following props should you suggest to clients with tight muscles and physical restrictions? A. Pillow and an exercise block B. Exer

How did the triple alliance and the triple entente change during the war?

What man made object is likely to endure long after humans have disappeared from new york city?

What plane contains points C, D, and G? Question 12 options: The plane on the bottom of the figure The plane on the top of the figure The plane on the front sid

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses

Can I get some help with these questions thank you

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat