demarionkiante demarionkiante

04-03-2021
Mathematics

contestada

The perimeter of a rectangle is 86. The length of the rectangle is one more than twice the width. Determine the length and width of the rectangle.

Respuesta :

1070944 1070944

04-03-2021

Answer:

Length is 22 width is 21

Step-by-step explanation:

half of 86 is 43.

22 and 21 make 43

Answer Link

Otras preguntas

join two pieces to form a word. pls help

If you were traveling in India, where would you see the bindhi most often?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Answer this and I’ll buy you McDonald’s

What makes atoms different than ions?

What are 2 achievements/accolades of Pancho Villa?

Raul and Athena make bumper stickers. They know that their fixed costs are $145 and the cost of each bumper sticker is $2. Write an equation for the total cost

the frequency of the middle b note on a piano is 493.88 hz. what is the wavelength of this note in centimeters? the speed of sound in air is 343.06 m/s.

Concrete was invented by the _____________ 2,000 years ago.

Zeke has already written 1 page, and he expects to write 1 page for every additional hour spent writing. After spending 49 hours writing this week, how many pag