cloudhellohhhh cloudhellohhhh

01-04-2021
Mathematics

contestada

hii please help i’ll give brainliest!!

hii please help ill give brainliest class=

Respuesta :

lolersgaming1 lolersgaming1

01-04-2021

Answer:

B

Step-by-step explanation:

Newton's third law states that for every force in nature there is an equal and opposite reaction.

Answer Link

Otras preguntas

PLS help me I need help with question 1

Solve the system of equations below by using the elimination or substitution method. -2x+8y= -14 { - 4x+y= -13

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

the name boston massacre was given to the events of march 5, 1770, in order to:

how did early people make clothes ?

What does this description of Tom Post suggest about his position on hydraulic fracturing? Use details from the passage to support your answer.

which of these regions of the vertebral column would be most accessible from a posterior surgical approach?

A scientist has 500 mL of a 2.1 M stock solution. She dilutes the solution, and the volume of the solution after the dilution is 3.25 L. What is the molarity (M

in the absence of specific therapy to interrupt transmission of hiv, an infected woman has what percent chance of having a child born with hiv?

easy question - will give brainly and more if correct!!!Tom deposited $2500 into a savings account that pays 4.5% interest per year. How much interest does tom