hipeople9525 hipeople9525
  • 03-11-2021
  • Mathematics
contestada

3 14/17 and 5 11/15 rounded to the nearest whole number

Respuesta :

adhorsedream adhorsedream
  • 04-11-2021

Answer: 4 and 6

Step-by-step explanation:

Because 14/17 is greater than half, you round up to the 4, same goes for the 11/15, it's greater than 1/2 (0.5) so you would round up to the 6.

Answer Link

Otras preguntas

What is the sum of 6/10 plus 7/12
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
why is it critical to your cells to be near capillaries
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
I want to work with LDAP. what is LDAP?
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5