xiomaramartinez7027 xiomaramartinez7027
  • 03-12-2021
  • History
contestada

what is the subject of kimigayo, the japanese national anthem?

Respuesta :

jordyncupp
jordyncupp jordyncupp
  • 03-12-2021

Answer:

After the Meiji Restoration, samurai from Satsuma-han controlled the Imperial Japanese government and they adopted "Kimigayo" as the national anthem of Japan

Explanation:

brainlist ple if you don't want to you don't

Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Simplify: 8p^4+6q^4.
Help me figure out the answer please​
By definition, a computer is a machine that has a screen uses the internet requires batteries works with information
A: {1,3,5,7,9} B: {1,2,4,9} If c={1,6,8,10}, express following sets with bit strings:((in the picture))
About how deep into the ocean do the Sun’s rays reach? WILL MARK BRAINLIEST
Which sentence uses the semicolon correctly? With explanation please
what temperature should vegetables be cooked at to hold them hot?
Someone please explain I am so confused
5 to the power of 1,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000.