YRNlightskin4489 YRNlightskin4489

02-03-2018
Biology

contestada

A human gene has 5 alleles. how many heterozygous genotypes are possible? 5 correct answer 10 15 20 25

Respuesta :

Dancer414 Dancer414

10-03-2018

the correct answer is 10

Answer Link

Otras preguntas

what are the zeros of the function? f(x)=+-6x

Explain how infection prevention policies and guidelines can be applied in own work setting.

Which is the best way to conserve worldwide freshwater resources? 1.increase the amount of land used to raise cattle 2.use more efficient irrigation technique

Do you think there are benefits to teaching prisoners about philosophy?

Attorney general a. mitchell palmer believed that he needed to protect the american people from

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which geographic characteristics makes Washington such an important state for international trade? A. It's distance from Canada and Mexico B. It's location on t

What do the tympanic membranes do for the frog?

what is the scale factor of a cube with a volume of 343 m^3 to a cube with a volume of 5'832 m^3?

If o- can give to every other blood type, why cant it recieve other blood types