Seudónimo Seudónimo
  • 02-03-2018
  • Mathematics
contestada

Which equation does the graph represent?

A) y = 2x
B) y = 1/2x
C) y = 1/2 + x
D) y = 2 + x

Which equation does the graph represent A y 2x B y 12x C y 12 x D y 2 x class=

Respuesta :

JimmyJohns33 JimmyJohns33
  • 02-03-2018
It is B because the equation for slope is x/y and when x=1 y=2 so it is 1/2
Answer Link
mysticaldogg
mysticaldogg mysticaldogg
  • 02-03-2018
slope = ½
y-int = 0

The graph represents equation y = ½x.

The correct answer is B. y = ½x.
Answer Link

Otras preguntas

Tu as quels cours le jeudi matin?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
does a human body use neon???
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
Explain who or what "Año Viejo" is and its significance.